CRISPR-Cas9 (Active) Protein

Produktnummer ABIN3071564

Dieses Recombinant -Protein wird in Escherichia coli (E. coli) produziert.

Kurzübersicht für CRISPR-Cas9 (Active) Protein (ABIN3071564)

Target: CRISPR-Cas9

Protein-Typ: Recombinant

Biologische Aktivität: Active

Spezies: Streptococcus pyogenes

Quelle: Escherichia coli (E. coli)

Applikation: In vitro Cleavage Assay (IVCA), Antibody Production (AbP), Genome Editing with Engineered Nucleases (GEEN)

Reinheit: > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.

Produktdetails

Spezifität: Activity test
Cas9 site-specific digestion:
We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
(CATCATTGGAAAACGTTCTT)
can be digested with gRNA:
(CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hours at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.

Produktmerkmale: GenCrispr Cas9 Nuclease is produced by expression in an E. colistrain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes without nuclear localization signal (NLS).

Aufreinigung: purified

Bestandteile: GenCrispr Cas9 Nuclease
10X Reaction Buffer

Anwendungsinformationen

Applikationshinweise: Screening for highly efficient and specific targeting gRNAs by in vitro DNA cleavage using Cas9 Nuclease from S. pyogenes
Highly purified Cas9 antigen could be used for specific antibody production.

Beschränkungen: Nur für Forschungszwecke einsetzbar

Handhabung

Konzentration: 0.2 mg/mL

Buffer: 10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
1X Storage Buffer: 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % Glycerol pH 7.4 at 25 °C

Konservierungsmittel: Dithiothreitol (DTT)

Vorsichtsmaßnahmen: This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.

Lagerung: -20 °C

Informationen zur Lagerung: GenCrispr Cas9 is supplied with 1X storage buffer (10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and is recommended to be stored at -20°C.br/>Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).

Antigendetails

Target: CRISPR-Cas9

Andere Bezeichnung: Cas9 Nuclease

Hintergrund: GenCrispr Cas9 Nuclease is the recombinant Streptococcus pyogenes Cas9 (wt) protein purified from E. coli that can be used for genome editing by inducing site-specific double stranded breaks in double stranded DNA. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The RNP complex recognizes the target site by matching gRNA with the genomic DNA sequence and produces DNA breaks within 3 bases from the NGG PAM (Protospacer Adjacent Motif). With GenCrispr Cas9 nuclease, customers can screen for highly efficient gRNA in vitro using DNA cleavage assays. The high purity Cas9 protein can also be used for antibody production.