Hydroxymethylbilane Synthase (HMBS) ELISA Kits

HMBS encodes a member of the hydroxymethylbilane synthase superfamily. Zusätzlich bieten wir Ihnen Hydroxymethylbilane Synthase Antikörper (104) und Hydroxymethylbilane Synthase Proteine (12) und viele weitere Produktgruppen zu diesem Protein an.

list all ELISA KIts Gen GeneID UniProt
HMBS 3145 P08397
HMBS 25709  
HMBS 15288 P22907
Direkt bei antikoerper-online bestellen
  • +1 877 302 8632
  • +1 888 205 9894 (toll-free)
  • Online bestellen
  • orders@antikoerper-online.de

Top Hydroxymethylbilane Synthase ELISA Kits auf antikoerper-online.de

Showing 5 out of 10 products:

Katalog Nr. Reaktivität Sensitivität Bereich Bilder Menge Lieferzeit Preis Details
Human 0.26 ng/mL 0.78 ng/mL - 50 ng/mL 96 Tests 13 bis 16 Tage
$736.84
Details
Human < 0.26 ng/mL 0.78 ng/mL - 50 ng/mL   96 Tests 11 bis 18 Tage
$902.56
Details
Maus
  96 Tests 11 bis 18 Tage
$731.99
Details
Rind (Kuh)
  96 Tests 15 bis 18 Tage
$1,029.60
Details
Ratte
  96 Tests 15 bis 18 Tage
$1,029.60
Details

Weitere ELISA Kits für Hydroxymethylbilane Synthase Interaktionspartner

Human Hydroxymethylbilane Synthase (HMBS) Interaktionspartner

  1. Using two bioinformatics pipelines for analysis of RNA fingerprints we identified significant effects of E. coli on the mRNAs HMBS, ATP2C1 and LRCH4. To see whether these three proteins were present in platelets and were influenced by the bacteria, we analysed HMBS, ATP2C1 and LRCH4 in platelet lysates and releasates by Western blot and ELISA.

  2. In the present study, we identified four HMBS gene mutations affecting the ubiquitous isoform of porphobilinogen deaminase (PBGD) and established a dPCR protocol which would be able to detect the different transcripts of this gene.

  3. Here we show that intravenous administration of human PBGD (hPBGD) mRNA (encoded by the gene HMBS) encapsulated in lipid nanoparticles induces dose-dependent protein expression in mouse hepatocytes, rapidly normalizing urine porphyrin precursor excretion in ongoing attacks

  4. In a Chinese female patient with very typical Acute intermittent porphyria symptoms, a heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation.

  5. Human hydroxymethylbilane synthase: Molecular dynamics of the pyrrole chain elongation identifies step-specific residues that cause acute intermittent porphyria.

  6. After a diagnostic odyssey, his urine porphobilinogen was found to be significantly elevated and genetic testing showed a previously unreported consensus splice-site mutation IVS4-1G>A in the HMBS gene confirming the diagnosis of Acute Intermittent Porphyria (AIP)

  7. The authors describe the biochemical characterisation of expressed HMBS mutants in a black South African population. This reveals insight into the mechanism of catalytic activity loss, which may inspire investigation into individualised therapy based on the molecular lesion identified.

  8. ALAS1 mRNA and activity were elevated approximately ~3- and 5-fold, and HMB synthase activity was approximately half-normal (~42%)

  9. A new mutation in intron 2 (IVS2-2Ag-->G) was identified in a Chinese family with acute intermittent porphyria.

  10. in the hepatic cancer tissue of two acute porphyria patients, somatic second-hit mutations result in nearly complete inactivation of PPOX and HMBS

  11. study of hydroxymethylbilane synthase mutations and polymorphisms in Brazilian families with acute intermittent porphyria

  12. Letter/Case Report: R173W mutation of HMBS gene can cause rhabdomyolysis in patients with variant acute intermittent porphyria.

  13. we report a novel PBGD missense mutation.

  14. Novel porphobilinogen deaminase gene mutations have been described in Polish patients with non-erythroid acute intermittent porphyria.

  15. Conformational stability and activity of hydroxymethylbilane synthase (HMSB) and the acute intermittent porphyria K132N and V215E HMSB mutations.

  16. Dense geographic aggregation with one identical haplotype strongly suggests a remote founder phenomenon for these Venezuelan acute intermittent porphyria families, carrying an unreported but most frequent HMBS mutation.

  17. Findings indicate that using TATA-binding protein (TBP) alone or in combination with hydroxymethylbilane synthase (HMBS) as endogenous controls could be a reliable method for normalizing qRT-PCR data in hepatoma cell lines treated with TNF-alpha.

  18. The novel mutations of HMBS gene were three missense (R26L, R173G and D178H), two frameshift (c.749_765dup and c.874insC) and one intronic deletion (IVS12+3_+11delAGGGCCTGT).

  19. The informative SNPs of HMBS gene reveal a distinctive haplotype which segregates with the R116W mutation present in the Dutch AIP families (-64T, 1345 G, 2479 G, 3581 G, 6479 T, 7064 C and 8578 A).

  20. One small deletion and six nucleotide substitutions within the 5'UTR and the housekeeping promoter of HMBS gene are found responsible for the non-erythroid form of acute intermittent porphyria.

Mouse (Murine) Hydroxymethylbilane Synthase (HMBS) Interaktionspartner

  1. New bioengineered PBGD variants (for gene therapy) capable of metabolizing the toxic heme precursors produced by the liver at an increased rate were evaluated.

  2. PBGD-deficient mice showed a different response to fasting as measured by altered carbohydrate metabolism in the liver and modified glucose consumption in the brain cortex. Glucose homeostasis in fasted PBGD-deficient mice was efficiently normalized after restoration of PBGD gene expression in the liver.

  3. Porphobilinogen deaminase over-expression in hepatocytes, albeit in a low proportion, reduced precursor accumulation, which is the hallmark of acute porphyric attacks.

  4. PBGD-deficient mice were characterized biochemically during phenobarbital induction of heme synthesis and enzyme replacement.

Hydroxymethylbilane Synthase (HMBS) Antigen-Profil

Beschreibung des Gens

This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.

Genbezeichner und Symbole assoziert mit HMBS

  • hydroxymethylbilane synthase (HMBS) Antikörper
  • hydroxymethylbilane synthase (Hmbs) Antikörper
  • hydroxymethylbilane synthase (hmbs) Antikörper
  • hydroxymethylbilane synthase S homeolog (hmbs.2.S) Antikörper
  • hydroxymethylbilane synthase L homeolog (hmbs.L) Antikörper
  • hydroxymethylbilane synthase (CNC02250) Antikörper
  • hydroxymethylbilane synthase (predicted) (hem3) Antikörper
  • hydroxymethylbilane synthase (hemC) Antikörper
  • Hydroxymethylbilane synthase (Trad_0335) Antikörper
  • hydroxymethylbilane synthase (Plabr_2100) Antikörper
  • hydroxymethylbilane synthase (Sgly_3113) Antikörper
  • hydroxymethylbilane synthase (SMLT_RS19660) Antikörper
  • hydroxymethylbilane synthase (PMI_RS16580) Antikörper
  • hydroxymethylbilane synthase a (hmbsa) Antikörper
  • hydroxymethylbilane synthase, b (hmbsb) Antikörper
  • DDBDRAFT_0186148 Antikörper
  • DDBDRAFT_0231417 Antikörper
  • DDB_0186148 Antikörper
  • DDB_0231417 Antikörper
  • hemC Antikörper
  • hmbs Antikörper
  • hmbsl Antikörper
  • id:ibd5004 Antikörper
  • im:7140060 Antikörper
  • NV50236 Antikörper
  • pbg-d Antikörper
  • pbgd Antikörper
  • PORC Antikörper
  • SPAC806.01 Antikörper
  • T25658 Antikörper
  • Ups Antikörper
  • URO-S Antikörper
  • Uros1 Antikörper
  • zgc:64128 Antikörper
  • zgc:110690 Antikörper

Bezeichner auf Proteinebene für HMBS

porphobilinogen deaminase , porphyria, acute; Chester type , pre-uroporphyrinogen synthase , uroporphyrinogen I synthase , uroporphyrinogen I synthetase , alternative name: porphobilinogen deaminase , hydroxymethylbilane synthase , Hydroxymethylbilane synthase , PBG-D , porphobilinogen deaminase-like , hydroxymethylbilane synthase, b

GENE ID SPEZIES
3145 Homo sapiens
25709 Rattus norvegicus
419701 Gallus gallus
448096 Xenopus (Silurana) tropicalis
495094 Xenopus laevis
515614 Bos taurus
702943 Macaca mulatta
734761 Xenopus laevis
3256245 Cryptococcus neoformans var. neoformans JEC21
3361383 Schizosaccharomyces pombe 972h-
8250098 Micromonas sp. RCC299
8624733 Dictyostelium discoideum AX4
9279308 Truepera radiovictrix DSM 17093
100121374 Nasonia vitripennis
15288 Mus musculus
10239509 Planctomyces brasiliensis DSM 5305
10250332 Syntrophobotulus glycolicus DSM 8271
100446876 Pongo abelii
6395026 Stenotrophomonas maltophilia K279a
6801447 Proteus mirabilis HI4320
394129 Danio rerio
489373 Canis lupus familiaris
396581 Sus scrofa
100720802 Cavia porcellus
338290 Danio rerio
Ausgewählte Anbieter für Hydroxymethylbilane Synthase (HMBS) ELISA Kits
Haben Sie etwas anderes gesucht?